MS_memer_group › doxxing Memes & GIFs

Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/7o5dh2 | MSmg archives: imgflip.com/i/8u9dsa | Discord: https://discord.gg/8tTMfAGfSH | Stream Mood: The holidays are here, have a great time everybody!

11624 followers

MS_memer_group

To post images in this stream, please .

Moderators

Heaven. ImgflipPain. Mack-The-Knife NobleRapier_ Festive_Cyrus Tiffmas Ser.Donald.P.Suttingsworth OWNER CommunityModerator OWNER DarthSwede OWNER Drizzy. OWNER KrewFam. OWNER -.Nugget.- AYMY Col.Konig SardineYoghurt Advictorim Noelle-Holiday Behapp veno_ Sauce. Dr.Festive-ish Cookie. Palmo P.R.E.S.E.N.T. ShadowSkul ObiWON Nermal.dunks.on.garfield SimoTheFinlandized goblin. Epsilon-11_Commander Lavender. Ducc-The-Ultimate Sally.Skellington people_r_us Goldside543 AlternateMemory

Create your own stream

Imgflip Pro

AI creation tools & better GIFs
No ads
Custom 6x6 profile icon and new colors
Your images are featured instantly in auto-approve-sfw streams
Your images jump to the top of approval queues

Go Pro

time to go on a little bizarre adventure

282 views, 15 upvotes, 4 comments

if sssniperwolf was a bio major

if sssniperwolf was a bio major | I'm going to dox your DNA sequence; CAGGCAGTCATGATGCGTATTAGCTAGCGTCGTAG
TCTAGTCTGAGTCATGCAGTACTGCATGCATTCTGA
TGCAGTACGTATGCTGACGTACTGCATGACTGCGT
ATGCATGAGTCCGATACGTCACGCGTAGTATGACG
ATAACTGACGTGCATAGCATGAGTCAGTCATGCAGT
ACTGACGTCAGTCATGCAGCAGTAGACGTCAGTCA
TGCATGCAGTCAGTCAGATCAGATGCGATGCAGTA
GTCATGCAGCAGCATGCAGTCAGTCAGTACGTCAT | image tagged in spicymasterchief's announcement template,memes,doxxing,biology,dna,shitpost | made w/ Imgflip meme maker

214 views, 3 upvotes, 5 comments

hand me my simp card but i guess looks can be decieving

hand me my simp card but i guess looks can be decieving | WHY WOULD SSSNIPERWOLF DOX? SHE LOOKS TOO CUTE AND INNOCENT TO DO SOMETHING THAT BAD. | image tagged in sssniperwolf gacha,memes,doxxing,anime girl,cute cat,simp | made w/ Imgflip meme maker

181 views, 2 upvotes, 24 comments

self doxxing

self doxxing | Hello Tony Stark from; Hello Walter White from; Tells the Mandarin his mansion's address, it gets blown up | image tagged in memes,blank comic panel 2x2,hello x from y,breaking bad,iron man,doxxing | made w/ Imgflip meme maker

145 views, 4 upvotes

not my drawing, a template i found

not my drawing, a template i found | SSSNIPERWOLF OR SOMETHING IDK; I ONLY WATCH HIGH QUALITY CONTENT | image tagged in lordreaperus but he s a tf2 sniper,sssniperwolf,youtubers,doxxing,or something idk,memes | made w/ Imgflip meme maker

165 views, 4 upvotes, 2 comments

Yeah

by Nuclear_Dekaus

409 views, 51 upvotes, 26 comments

by anonymous

157 views, 1 upvote, 5 comments

i have skill issues :'(

249 views, 6 upvotes, 2 comments

"It's just a prank, bro"

162 views, 3 upvotes