Imgflip Logo Icon

MS_memer_group › doxxing Memes & GIFs

Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/7o5dh2 | Discord: https://discord.gg/jfA2AFApfC | MSmg archives: imgflip.com/i/8u9dsa | Copypasta Microwave: imgflip.com/i/6u6sek | Stream Mood: They don't have bread?

Imgflip Pro

  • AI creation tools & better GIFs
  • No ads
  • Custom 6x6 profile icon and new colors
  • Your images are featured instantly in auto-approve-sfw streams
  • Your images jump to the top of approval queues
Go Pro

if sssniperwolf was a bio major

if sssniperwolf was a bio major | I'm going to dox your DNA sequence; CAGGCAGTCATGATGCGTATTAGCTAGCGTCGTAG
TCTAGTCTGAGTCATGCAGTACTGCATGCATTCTGA
TGCAGTACGTATGCTGACGTACTGCATGACTGCGT
ATGCATGAGTCCGATACGTCACGCGTAGTATGACG
ATAACTGACGTGCATAGCATGAGTCAGTCATGCAGT
ACTGACGTCAGTCATGCAGCAGTAGACGTCAGTCA
TGCATGCAGTCAGTCAGATCAGATGCGATGCAGTA
GTCATGCAGCAGCATGCAGTCAGTCAGTACGTCAT | image tagged in spicymasterchief's announcement template,memes,doxxing,biology,dna,shitpost | made w/ Imgflip meme maker
249 views, 3 upvotes, 5 comments

self doxxing

self doxxing | Hello Tony Stark from; Hello Walter White from; Tells the Mandarin his mansion's address, it gets blown up | image tagged in memes,blank comic panel 2x2,hello x from y,breaking bad,iron man,doxxing | made w/ Imgflip meme maker
187 views, 4 upvotes

not my drawing, a template i found

not my drawing, a template i found | SSSNIPERWOLF OR SOMETHING IDK; I ONLY WATCH HIGH QUALITY CONTENT | image tagged in lordreaperus but he s a tf2 sniper,sssniperwolf,youtubers,doxxing,or something idk,memes | made w/ Imgflip meme maker
202 views, 4 upvotes, 2 comments

Yeah

427 views, 51 upvotes, 26 comments
by anonymous
166 views, 1 upvote, 5 comments