Imgflip Logo Icon

MS_memer_group › doxxing Memes & GIFs

Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/9v4nax | MSmg archives: imgflip.com/i/8u9dsa | Copypasta Microwave: imgflip.com/i/6u6sek | 🚨🚨 𝐌𝐒𝐌𝐆 𝐖𝐄𝐁𝐒𝐈𝐓𝐄 𝐈𝐒 𝐓𝐇𝐄𝐑𝐄: 🚨🚨 | Stream Mood: Don't ask, don't tell.

Imgflip Pro

  • AI creation tools & better GIFs
  • No ads
  • Custom 6x6 profile icon and new colors
  • Your images jump to the top of approval queues
Go Pro

if sssniperwolf was a bio major

if sssniperwolf was a bio major | I'm going to dox your DNA sequence; CAGGCAGTCATGATGCGTATTAGCTAGCGTCGTAG
TCTAGTCTGAGTCATGCAGTACTGCATGCATTCTGA
TGCAGTACGTATGCTGACGTACTGCATGACTGCGT
ATGCATGAGTCCGATACGTCACGCGTAGTATGACG
ATAACTGACGTGCATAGCATGAGTCAGTCATGCAGT
ACTGACGTCAGTCATGCAGCAGTAGACGTCAGTCA
TGCATGCAGTCAGTCAGATCAGATGCGATGCAGTA
GTCATGCAGCAGCATGCAGTCAGTCAGTACGTCAT | image tagged in spicymasterchief's announcement template,memes,doxxing,biology,dna,shitpost | made w/ Imgflip meme maker
348 views, 5 upvotes, 4 comments

self doxxing

self doxxing | Hello Tony Stark from; Hello Walter White from; Tells the Mandarin his mansion's address, it gets blown up | image tagged in memes,blank comic panel 2x2,hello x from y,breaking bad,iron man,doxxing | made w/ Imgflip meme maker
307 views, 5 upvotes

not my drawing, a template i found

not my drawing, a template i found | SSSNIPERWOLF OR SOMETHING IDK; I ONLY WATCH HIGH QUALITY CONTENT | image tagged in lordreaperus but he s a tf2 sniper,sssniperwolf,youtubers,doxxing,or something idk,memes | made w/ Imgflip meme maker
296 views, 5 upvotes, 2 comments

Yeah

477 views, 52 upvotes, 26 comments
by anonymous
251 views, 1 upvote, 5 comments