Imgflip Logo Icon

MS_memer_group › dna Memes & GIFs

Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/9v4nax | Discord: https://discord.gg/jfA2AFApfC | MSmg archives: imgflip.com/i/8u9dsa | Copypasta Microwave: imgflip.com/i/6u6sek | Certified Flag Ignorer: AYMY 🎉

Imgflip Pro

  • AI creation tools & better GIFs
  • No ads
  • Custom 6x6 profile icon and new colors
  • Your images are featured instantly in auto-approve-sfw streams
  • Your images jump to the top of approval queues
Go Pro

pizza time is gone

pizza time is gone | WHEN YOU TAKE A DNA TEST FIND OUT YOU'RE NOT ITALIAN | image tagged in pizza time stops,dna | made w/ Imgflip meme maker
67 views, 4 upvotes, 5 comments

Idk what to caption this with

Idk what to caption this with | image tagged in memes,dna | made w/ Imgflip meme maker
60 views, 2 upvotes, 1 comment

DNA

DNA | ME ANALYZING WHY TF Y'ALL SO DELUSIONAL WHEN IT COMES TO DECISIONS: | image tagged in dna | made w/ Imgflip meme maker
100 views, 6 upvotes, 2 comments

if sssniperwolf was a bio major

if sssniperwolf was a bio major | I'm going to dox your DNA sequence; CAGGCAGTCATGATGCGTATTAGCTAGCGTCGTAG
TCTAGTCTGAGTCATGCAGTACTGCATGCATTCTGA
TGCAGTACGTATGCTGACGTACTGCATGACTGCGT
ATGCATGAGTCCGATACGTCACGCGTAGTATGACG
ATAACTGACGTGCATAGCATGAGTCAGTCATGCAGT
ACTGACGTCAGTCATGCAGCAGTAGACGTCAGTCA
TGCATGCAGTCAGTCAGATCAGATGCGATGCAGTA
GTCATGCAGCAGCATGCAGTCAGTCAGTACGTCAT | image tagged in spicymasterchief's announcement template,memes,doxxing,biology,dna,shitpost | made w/ Imgflip meme maker
273 views, 4 upvotes, 5 comments

haha protein synthesis go brrr

haha protein synthesis go brrr | RNA: Can I copy your homework?
DNA: Sure, just change one thing so it doesn't look like we're cheating.
RNA: Ok
*changes thymine to uracil* | image tagged in meme man science,dna,biology,science,homework,memes | made w/ Imgflip meme maker
2,491 views, 8 upvotes, 7 comments