MS_memer_group › biology Memes & GIFs

Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/7o5dh2 MSmg archives: imgflip.com/i/8u9dsa | Copypasta Microwave: imgflip.com/i/6u6sek | Discord: https://discord.gg/8tTMfAGfSH | Stream Mood: MSmg Bingus Week™ next!

11499 followers

MS_memer_group

To post images in this stream, please .

Moderators

Heaven. Mack-The-Knife NobleRanger_ Jesvur. -americium- while-true-do-end Ser.Donald.P.Suttingsworth OWNER DarthSwede OWNER Asriel-Lalonde Behapp CommunityModerator OWNER KrewFam. OWNER Thanksgiving_Foxy501 Festive_Cyrus AYMY BigBootyBob J.ROY Drizzy. OWNER OnlineTherapist ShadowSkul -.Nugget.- iunfunnydidnothingwrong Captain_Scar Sauce. Austr1anF4tal-K0nig SimoTheFinlandized Palmo man_of_seven_shingles ObiWON Funguy. Brattmann _.Shiver._ Cookie. SardineYoghurt people_r_us AlternateMemoryLikesMonstercat PlushShowGeeks Grass... Dr.Evil-ish Lavender.

Create your own stream

Imgflip Pro

AI creation tools & better GIFs
No ads
Custom 6x6 profile icon and new colors
Your images are featured instantly in auto-approve-sfw streams
Your images jump to the top of approval queues

Go Pro

if sssniperwolf was a bio major

if sssniperwolf was a bio major | I'm going to dox your DNA sequence; CAGGCAGTCATGATGCGTATTAGCTAGCGTCGTAG
TCTAGTCTGAGTCATGCAGTACTGCATGCATTCTGA
TGCAGTACGTATGCTGACGTACTGCATGACTGCGT
ATGCATGAGTCCGATACGTCACGCGTAGTATGACG
ATAACTGACGTGCATAGCATGAGTCAGTCATGCAGT
ACTGACGTCAGTCATGCAGCAGTAGACGTCAGTCA
TGCATGCAGTCAGTCAGATCAGATGCGATGCAGTA
GTCATGCAGCAGCATGCAGTCAGTCAGTACGTCAT | image tagged in spicymasterchief's announcement template,memes,doxxing,biology,dna,shitpost | made w/ Imgflip meme maker

209 views, 3 upvotes, 5 comments

am I decently cool now? prob not

am I decently cool now? prob not | EVEN THOUGH WHEN DIDN'T REACH IT, I AM A MAN OF MY WORD | image tagged in memes,school,biology,funny memes | made w/ Imgflip meme maker

by Retired_Mudkip

102 views, 8 upvotes

Yuh

by The_Black_Man_Requiem_Go_Beyond

367 views, 9 upvotes, 2 comments

True

True | CIS PEOPLE: TRANS PEOPLE NEED TO GO TO A BIOLOGY CLASS. ALSO CIS PEOPLE: "DRAW TITS ON A DUCK TO INDICATE THAT IT IS A GIRL" | image tagged in memes,blank transparent square,gender,transgender,cisgender,biology | made w/ Imgflip meme maker

by anonymous

289 views, 4 upvotes, 33 comments

haha protein synthesis go brrr

haha protein synthesis go brrr | RNA: Can I copy your homework?
DNA: Sure, just change one thing so it doesn't look like we're cheating.
RNA: Ok
*changes thymine to uracil* | image tagged in meme man science,dna,biology,science,homework,memes | made w/ Imgflip meme maker

2,104 views, 7 upvotes, 7 comments

final 5

by SinOfTreachery

84 views, 3 upvotes, 7 comments

Show More

by Chubnub-returns

162 views, 2 upvotes, 2 comments

Best,Better, Blurst

by Chubnub-returns

123 views, 2 upvotes, 1 comment

ok i will stop[

by anonymous

157 views, 8 upvotes, 2 comments