Imgflip Logo Icon

MS_memer_group › biology Memes & GIFs

Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/9v4nax | Discord: https://discord.gg/jfA2AFApfC | MSmg archives: imgflip.com/i/8u9dsa | Copypasta Microwave: imgflip.com/i/6u6sek | Stream Mood: whos gunna update the stream mood

Imgflip Pro

  • AI creation tools & better GIFs
  • No ads
  • Custom 6x6 profile icon and new colors
  • Your images jump to the top of approval queues
Go Pro

No Luck With The Other Parent, Though :(

No Luck With The Other Parent, Though :( | Update:
I found my bio!mom.
Slight problem, though.
She died a few years ago.
But, at least, I got some
questions answered. :') | image tagged in km spectate shared temp,biology,mother,found,dead,happy sad | made w/ Imgflip meme maker
88 views, 3 upvotes, 20 comments
Check the NSFW checkbox to enable not-safe-for-work images
NSFW
57 views, 4 upvotes, 5 comments

if sssniperwolf was a bio major

if sssniperwolf was a bio major | I'm going to dox your DNA sequence; CAGGCAGTCATGATGCGTATTAGCTAGCGTCGTAG
TCTAGTCTGAGTCATGCAGTACTGCATGCATTCTGA
TGCAGTACGTATGCTGACGTACTGCATGACTGCGT
ATGCATGAGTCCGATACGTCACGCGTAGTATGACG
ATAACTGACGTGCATAGCATGAGTCAGTCATGCAGT
ACTGACGTCAGTCATGCAGCAGTAGACGTCAGTCA
TGCATGCAGTCAGTCAGATCAGATGCGATGCAGTA
GTCATGCAGCAGCATGCAGTCAGTCAGTACGTCAT | image tagged in spicymasterchief's announcement template,memes,doxxing,biology,dna,shitpost | made w/ Imgflip meme maker
288 views, 4 upvotes, 5 comments

True

by anonymous
354 views, 4 upvotes, 33 comments

haha protein synthesis go brrr

2,540 views, 8 upvotes, 7 comments

final 5

116 views, 3 upvotes, 7 comments
Show More
204 views, 2 upvotes, 2 comments

Best,Better, Blurst

151 views, 2 upvotes, 1 comment

ok i will stop[

by anonymous
202 views, 8 upvotes, 2 comments