Imgflip Logo Icon

MS_memer_group › biology Memes & GIFs

Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/7o5dh2 | MSmg archives: imgflip.com/i/8u9dsa | Discord: https://discord.gg/8tTMfAGfSH | Stream Mood: Upcoming Project < Colette Collectables

Imgflip Pro

  • AI creation tools & better GIFs
  • No ads
  • Custom 6x6 profile icon and new colors
  • Your images are featured instantly in auto-approve-sfw streams
  • Your images jump to the top of approval queues
Go Pro

if sssniperwolf was a bio major

if sssniperwolf was a bio major | I'm going to dox your DNA sequence; CAGGCAGTCATGATGCGTATTAGCTAGCGTCGTAG
TCTAGTCTGAGTCATGCAGTACTGCATGCATTCTGA
TGCAGTACGTATGCTGACGTACTGCATGACTGCGT
ATGCATGAGTCCGATACGTCACGCGTAGTATGACG
ATAACTGACGTGCATAGCATGAGTCAGTCATGCAGT
ACTGACGTCAGTCATGCAGCAGTAGACGTCAGTCA
TGCATGCAGTCAGTCAGATCAGATGCGATGCAGTA
GTCATGCAGCAGCATGCAGTCAGTCAGTACGTCAT | image tagged in spicymasterchief's announcement template,memes,doxxing,biology,dna,shitpost | made w/ Imgflip meme maker
214 views, 3 upvotes, 5 comments

True

True | CIS PEOPLE: TRANS PEOPLE NEED TO GO TO A BIOLOGY CLASS. ALSO CIS PEOPLE: "DRAW TITS ON A DUCK TO INDICATE THAT IT IS A GIRL" | image tagged in memes,blank transparent square,gender,transgender,cisgender,biology | made w/ Imgflip meme maker
by anonymous
300 views, 4 upvotes, 33 comments

haha protein synthesis go brrr

2,153 views, 7 upvotes, 7 comments

final 5

91 views, 3 upvotes, 7 comments
Show More
171 views, 2 upvotes, 2 comments

Best,Better, Blurst

130 views, 2 upvotes, 1 comment

ok i will stop[

by anonymous
166 views, 8 upvotes, 2 comments