Imgflip Logo Icon
Welcome to MS_memer_group. Earn your PhD in shitposting during your spare time, feel free to use this handy study guide: imgflip.com/i/9v4nax | Discord: https://discord.gg/jfA2AFApfC | MSmg archives: imgflip.com/i/8u9dsa | Copypasta Microwave: imgflip.com/i/6u6sek | Stream Mood: ꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂꧁꧂

Imgflip Pro

  • AI creation tools & better GIFs
  • No ads
  • Custom 6x6 profile icon and new colors
  • Your images jump to the top of approval queues
Go Pro
made w/ Imgflip meme maker
100 views, 4 upvotes, 1 comment

It's just doxxed your dna

It's just doxxed your dna | CAGTACTAGATCGGATACGGTAATGATT | image tagged in osde plush thanks disco | made w/ Imgflip meme maker
by anonymous
94 views, 5 upvotes, 4 comments
made w/ Imgflip meme maker
by anonymous
67 views, 5 upvotes, 2 comments
by anonymous
217 views, 5 upvotes, 1 comment

if you don't use it, you may continue

if you don't use it, you may continue | STOP; show me your most recent C.AI chat | image tagged in engineer pov | made w/ Imgflip meme maker
88 views, 3 upvotes, 39 comments
100 views, 6 upvotes, 6 comments
119 views, 2 upvotes, 4 comments
87 views, 2 upvotes, 1 comment
by anonymous
96 views, 8 upvotes, 6 comments
95 views, 6 upvotes, 6 comments

Disco's purple template

86 views, 4 upvotes, 9 comments

scale trend

Show More
by anonymous
80 views, 2 upvotes, 4 comments