Imgflip Logo Icon

(picture from Disney Robin Hood movie in 1973, if credit is required)

(picture from Disney Robin Hood movie in 1973, if credit is required) | so, I don't feel right; my throat feels funny(i've noticed mucus buildup), I feel a lot more warm, my nose is runny(from time to time every hour), and I'm feeling more tired than I should, not to mention the fact that I'm getting increasingly irritable. Is there a problem? | image tagged in robin hood tied up | made w/ Imgflip meme maker
802 views β€’ 9 upvotes β€’ Made by anonymous 2 years ago in Furries-stream
Robin Hood tied up memeCaption this Meme
32 Comments
[deleted] M
2 ups, 2y,
2 replies
made w/ Imgflip meme maker
So, it's out: I have a cold. Fever of 99.6(body temp is normally 97.5), Mucus Buildup, Runny Nose, Sneezing, Coughing, and increasing irritability. I hope I get better soon, but expect me to be FAR less active than I should be. Have a good Memorial Day tomorrow(if it isn't already, if you're in a different timezone)!

(Image by TrevArt on Fur Affinity)
2 ups, 2y
Hope you recover swiftly!
1 up, 2y,
1 reply
I send my prayers and wishes that you get better soon πŸ™
[deleted] M
0 ups, 2y,
1 reply
thanks mate
0 ups, 2y
i think thats more of a fever, not just a cold
[deleted] M
1 up, 2y,
1 reply
Diagnosis | Common cold | image tagged in diagnosis | made w/ Imgflip meme maker
0 ups, 2y,
1 reply
dark people scary 😨 (this is joke)
[deleted] M
0 ups, 2y,
1 reply
How... why? How did you get the idea to type that?
0 ups, 2y,
2 replies
becuz dark people scary😨
0 ups, 2y
nah, iceu. did something like this a while back, like.. in March of last year
[deleted] M
0 ups, 2y,
1 reply
You forgot the /j.
0 ups, 2y,
1 reply
wait what?
[deleted] M
0 ups, 2y,
2 replies
GACTCACAGGCCTCCGCCTTTAGGCGGTGCTTACTCTTACATAAAGGGGCTGTTAGTATTACCCCGCGAGGATTCGAAAAGGTGAGCCAACCCGGCCGATCCGGAGAGACGGGCCTCAAAGCCGCGTGACGACGGCTGTGGGCCCGTAACAAAATCCCCGCAATAAGCTCCCGTGAGCGTCGGTTGAACAGCCCTGGTCGGCCCCATCAGTAGCCCGAATATGTCGCTTTACGGGTCCTGGGCCGGGGTGCGATACCTTGCAGAAATCGAGGCCGTTCGTTAATTCCTGTTGCATTCGTACCGCCTATATTTGTCTCTTTGCCGGCTTATATGGACAAGCATAGCATAGCCATTTATCGGAGCGCCTCCGTACACGGTATGATCGGACGCCTCGTGAGATCAATACGTATACCAGGTGTCCTGTGAGCAGCGAAAGCCTATACGCGAGATACACTGCCAAAAATCCGCGTGATTACGAGTCGTGGCAAATTTGGTCTGGCTGTGGTCTAGACATTCCAGGCGGTGCGTCTGCTCTCGGGTGCCTCTAGTGGCTGGCTAGATAGACTAGCCGCTGGTAAACACACCATGACCCCGGCTCTCCATTGATGCCACGGCGATTGTTGGAGAGCCAGCAGCGACTGCAAACATCAGATCAGAGTAATACTAGCATGCGATAAGTCCCTAACTGACTATGGCCTTCTGTAGAGTCAACTTCACCACATATGCTGTCTCTGGCACGTGGATGGTTTAGAGGAATCAGATTCAAGTCTGGTTAACCATCAAACAGGTCTTGAGTCTAAAATTGTCGTCTCCTGCGTACGAGATGGAAATACTAGGTAACTACAGGGACTCCGACGTTATGTACGTTGCTCCGTCAGAGGCGCCATTCAGGATCACGTTACCGCGAAAAAAAGGGACCAGGAGCTCTTCTCCCCTGCGGTCACGTCTATAGAAATTACACCATTAACCCTCCTGAGAACCGGGAGGCGGGAATCCGTCACGTATGAGAAGGTATTTGCCCGATAATCAATACCCCAGGCTTCTAACTTTTTCCACT
0 ups, 2y,
1 reply
oh yeah? well dark people scarier 😨
[deleted] M
0 ups, 2y,
1 reply
Genome lol
0 ups, 2y,
1 reply
dark people genome 😨 😨 😨 😨 😨 😨 😨 😨 😭😭😭😭😭😭😭😭😭
[deleted] M
0 ups, 2y
Actually, it's a random genome I had lying around on my clipboard.

Please don't ask why I have random genomes in my clipboard.
[deleted] M
0 ups, 2y,
2 replies
the f**k is this lmao
[deleted] M
0 ups, 2y,
2 replies
A genome.
[deleted] M
0 ups, 2y,
1 reply
a Genome?
[deleted] M
0 ups, 2y
I just commented a random DNA sequence.
[deleted] M
0 ups, 2y,
1 reply
ooooh that makes sense
[deleted] M
0 ups, 2y
Can you MC?
[deleted] M
0 ups, 2y
lemme check
1 up, 2y,
1 reply
it's either allergies or a cold all in all nothing too bad
[deleted] M
1 up, 2y,
1 reply
It's a cold
1 up, 2y,
1 reply
k
1 up, 2y
hope you get better
[deleted]
0 ups, 2y,
1 reply
yeyeye :3
[deleted] M
1 up, 2y,
1 reply
piss
[deleted]
0 ups, 2y
damn
0 ups, 2y
Doctor:its just a cough
Parents:its just a cough
google: you have cancer
Robin Hood tied up memeCaption this Meme
Created with the Imgflip Meme Generator
IMAGE DESCRIPTION:
so, I don't feel right; my throat feels funny(i've noticed mucus buildup), I feel a lot more warm, my nose is runny(from time to time every hour), and I'm feeling more tired than I should, not to mention the fact that I'm getting increasingly irritable. Is there a problem?